Review



addgene pmd2 g  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 98
      Buy from Supplier

    Structured Review

    Addgene inc addgene pmd2 g
    Addgene Pmd2 G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 14830 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmd2+g+addgene/pMD2%2EG+(Plasmid+%2312259)/pmc12857616-194-6-6
    Average 98 stars, based on 14830 article reviews
    addgene pmd2 g - by Bioz Stars, 2026-10
    98/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: An orthogonal CRISPR/Cpf1 platform for precise spatiotemporal gene regulation and osteoporotic fracture repair.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER TIDE analysis primers, See: Table S4 This paper N/A Recombinant DNA OREC Effector sequences, see: Table S5 This paper N/A pAAV-MCS2 Addgene Cat# 46954 pAAV2/9 Addgene Cat# 112865 pHelper plasmid Addgene Cat# 112867 pcDNA3.1+N-DYK GenScript NA pUC57-Kan Addgene 121344 pCDH-CMV Addgene Cat# 72265 pCDH-CMV-MCS-EF1-copGFP System Biosciences Cat# CD511B-1 pMDLg/pRRE Addgene Cat# 12251 pRSV-Rev Addgene Cat# 12253 pMD2.G Addgene Cat# 12259 Software and algorithms GraphPad Prism 9 GraphPad Software https://www.graphpad.com NanoDrop 2000 Thermo Fisher Scientific https://www.thermofisher.com Skyscan Micro-CT software Bruker https://www.bruker.com ImageJ software NIH https://imagej.nih.gov/ij/ e2 Cell Reports Methods 6, 101299, February 23, 2026 Article ll OPEN ACCESS positioned directly over the fracture site. ..

    Article Title: Lipocalin 2 orchestrates resistance to ferroptosis via AXL.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Phosphatase inhibitor cocktail Sigma-Aldrich Cat #P5725 PMSF Sigma-Aldrich Cat #10837091001 Sodium acetate ThermoFisher Cat #A13184-30 Thioglycolic acid Fisher Scientific Cat #M0052252G Chromogenic solution (FerroZine) MedChemExpress Cat #HY-137805 FITC-annexin V BioLegend Cat #640914 DRAQ7 ThermoFisher Cat #D15105 Critical commercial assays CellTiter Glo Cell Viability Assay Promega Cat #G7573 RNeasy Mini Kit Qiagen Cat #74106 qScript cDNA SuperMix Quanta Biosciences Cat #95048-100 Fast SYBR Green Mastermix ThermoFisher Cat #4385618 Proteome Profiler Mouse Phospho-RTK Array Kit R&D Systems Cat#ARY014 Experimental models: Cell lines OL61 (mouse glioma) Castro-Lowenstein Laboratory, Univ. .. Michigan See STAR Methods KR158 (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods CPA (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods Experimental models: Organisms/strains C57BL/6 JAX RRID:IMSR_JAX:000664 NOD.Cg-Prkdc scid Il2rg tm1Wjl /SzJ Biological Resources Unit, Lerner Research Institute; Cleveland Clinic – B6.129P2-Lcn2 tm1Aade /AkiJ KAX RRID:IMSR_JAX:024630 Oligonucleotides LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 LCN2 Reverse: TTCCGCGGGTGACAGGGCTTC This paper See Table S1 GAPDH Forward: AGGCTGGTGACGAGGATTTG This paper See Table S1 GAPDH Reverse: TGTAGACCAGTATGTTGAGGTCA This paper See Table S1 LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 AXL Forward: ATGGCCGACATTGCCAGTG This paper See Table S1 AXL Reverse: CGGTAGTAATCCCCGTTGTAGA This paper See Table S1 OPCML Forward: CCACCCTCAGGTGTACCATAG This paper See Table S1 OPCML Reverse: GTAGGCGTGTTGACCAAAATGA This paper See Table S1 Gas6 Forward: TGCTGGCTTCCGAGTCTTC This paper See Table S1 Gas6 Reverse: CGGGGTCGTTCTCGAACAC This paper See Table S1 TENC1 Forward: TGAACCACTCAAAGCAACGCA This paper See Table S1 TENC1 Reverse: CGTTACATAGGTGAGGTCCAAGT This paper See Table S1 Recombinant DNA psPAX2 Addgene (Didier Trono) RRID:Addgene_12260; Cat# 12260 pMD2.G Addgene (Didier Trono) RRID:Addgene_12259; Cat# 12259 MISSION pLKO.1-puro Non-Mammalian shRNA Control Sigma TRC #SHC002 Lcn2 shRNA KD1 Sigma TRC #TRCN0000055328 Lcn2 shRNA KD2 Sigma TRC #TRCN0000055331 Lcn2 shRNA KD3 Sigma TRC #TRCN0000055332 Software and algorithms PRISM GraphPad https://www.graphpad.com/ FlowJo v10 BD Biosciences https://www.flowjo.com/ (Continued on next page) Cell Reports 45, 116965, March 24, 2026 17 .. STAR★METHODS Detailed methods are provided in the online version of this paper and include the following: • KEY RESOURCES TABLE • EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS ○ Sex as a biological variable ○ Cell culture ○ Intracranial tumor cell implantation ○ Patient mRNA expression and survival ○ Protein analysis of banked human samples ○ Study approval • METHOD DETAILS ○ Cell viability and functional assays ○ Lipid peroxidation ○ Cell number and proliferation ○ IC 50 assessment of drugs and drug matrix ○ Quantitative real-time PCR ○ Protein analysis ○ Enzyme-linked immunosorbent assay ○ Lcn2 genetic manipulation via short hairpin RNA knockdown ○ Iron measurements ○ Histology Cell Reports 45, 116965, March 24, 2026 11 • QUANTIFICATION AND STATISTICAL ANALYSIS SUPPLEMENTAL INFORMATION Supplemental information can be found online at https://doi.org/10.1016/j.

    Article Title: Functional chromatin signatures premark future lineage-specific enhancers.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and gRNAs N/A Recombinant DNA Lenti-dCas9-VP64 Addgene (Konermann et al.15) Cat# 61425 Lenti-EF1-MS2-P65-HSF1 Addgene (Konermann et al.15) Cat# 61426 LentiGuide-Puromycin Addgene (Sanjana et al.52) Cat# 52963 Lenti MS2 grna-Puromycin Addgene (Konermann et al.15) Cat# 73795 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat12259 CROP-sgRNA-MS2 Addgene (Alda-Catalinas et al.26) Cat#153457 Software and algorithms ImageJ Schneider et al.53 https://ImageJ.net/ Flowjo BD Life Sciences https://flowjo.com/ Model-based Analysis of ChIP-Seq (MACS) Zhang et al.54 https://macs3-project.github.io/MACS/ HOMER Heinz et al.23 http://homer.ucsd.edu/homer/index.html SCEPTRE Barry et al.28 https://katsevich-lab.github.io/sceptre/ Other Essential 8 (E8) Thermo Fisher Scientific A1517001 AMPure XP beads Beckman Coulter A63881 TrypLE Select Gibco 12563029 e2 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS Memorial Sloan Kettering Cancer Center (MSKCC) Antibody & Bioresource Core Facility to verify they were mycoplasma-free. ..

    Article Title: A bispecific nanobody-drug conjugate targeting TROP2 and c-Met for low-concentration, single-dose treatment of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: C57BL/6-Egfrtm2(EGFR)Bcgen Mettm1(MET)Bcgen Hgftm2(HGF)Bcgen/ Bcgen Biocytogen Cat#112258 Recombinant DNA pMCS-Gaussia-Dura Luc Vector for Luciferase Assays Thermo Fisher Cat#16190 pCDH-CMV-MCS-EF1-CopGFP-T2A-Puro NovoPro Cat#V012884 psPAX2 addgene Cat#12260 pMD2.G addgene Cat12259 Software and algorithms ImageJ Java 1.8.0_345 (64-bit) National Institutes of Health https://imagej.net/ij/ GraphPad Prism (v8.0) GraphPad https://www.graphpad.com/ Flowjo (v10.0.7) BD Life Sciences https://www.flowjo.com/ ZEN (blue edition v3.3) Carl Zeiss https://www.zeiss.com.cn/microscopy/ products/software/zeiss-zen.html LAS X office 1.4.7.28982 LAS X Life Science https://www.leica-microsystems.com.cn/ cn/c/gl/las-x-software-registration/ Living image (v4.4) Revvity https://www.revvity.cn/category/in-vivo- imaging-software SnapGene (v6.0.2) GSL Biotech LLC https://www.snapgene.com/ Other LSRFortessaX-20 BD Biosciences https://www.bdbiosciences.com/zh-cn TEM (HT7800) Hitachi https://www.hitachi.com.cn/ Biacore TM 8 series SPR systems Cytiva https://www.cytivalifesciences.com/ TCS SP8 X Leica https://www.leica-microsystems.com.cn/ cn/ Xevo G3 QTof Waters https://www.waters.com/nextgen/cn/zh. html Protein structure prediction AlphaFold 3 https://alphafold.com/ Cell Reports Medicine 7, 102688, April 21, 2026 e3 OPEN ACCESS sections underwent antigen retrieval and were then blocked. .. Antibodies against TROP2 (27360-1-AP, Proteintech) and c-Met (25869-1-AP, Proteintech) were applied at dilutions of 1:200 and 1:2000, respectively, and incubated for one hour at room temperature.

    Plasmid Preparation:

    Article Title: An orthogonal CRISPR/Cpf1 platform for precise spatiotemporal gene regulation and osteoporotic fracture repair.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER TIDE analysis primers, See: Table S4 This paper N/A Recombinant DNA OREC Effector sequences, see: Table S5 This paper N/A pAAV-MCS2 Addgene Cat# 46954 pAAV2/9 Addgene Cat# 112865 pHelper plasmid Addgene Cat# 112867 pcDNA3.1+N-DYK GenScript NA pUC57-Kan Addgene 121344 pCDH-CMV Addgene Cat# 72265 pCDH-CMV-MCS-EF1-copGFP System Biosciences Cat# CD511B-1 pMDLg/pRRE Addgene Cat# 12251 pRSV-Rev Addgene Cat# 12253 pMD2.G Addgene Cat# 12259 Software and algorithms GraphPad Prism 9 GraphPad Software https://www.graphpad.com NanoDrop 2000 Thermo Fisher Scientific https://www.thermofisher.com Skyscan Micro-CT software Bruker https://www.bruker.com ImageJ software NIH https://imagej.nih.gov/ij/ e2 Cell Reports Methods 6, 101299, February 23, 2026 Article ll OPEN ACCESS positioned directly over the fracture site. ..

    Software:

    Article Title: An orthogonal CRISPR/Cpf1 platform for precise spatiotemporal gene regulation and osteoporotic fracture repair.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER TIDE analysis primers, See: Table S4 This paper N/A Recombinant DNA OREC Effector sequences, see: Table S5 This paper N/A pAAV-MCS2 Addgene Cat# 46954 pAAV2/9 Addgene Cat# 112865 pHelper plasmid Addgene Cat# 112867 pcDNA3.1+N-DYK GenScript NA pUC57-Kan Addgene 121344 pCDH-CMV Addgene Cat# 72265 pCDH-CMV-MCS-EF1-copGFP System Biosciences Cat# CD511B-1 pMDLg/pRRE Addgene Cat# 12251 pRSV-Rev Addgene Cat# 12253 pMD2.G Addgene Cat# 12259 Software and algorithms GraphPad Prism 9 GraphPad Software https://www.graphpad.com NanoDrop 2000 Thermo Fisher Scientific https://www.thermofisher.com Skyscan Micro-CT software Bruker https://www.bruker.com ImageJ software NIH https://imagej.nih.gov/ij/ e2 Cell Reports Methods 6, 101299, February 23, 2026 Article ll OPEN ACCESS positioned directly over the fracture site. ..

    Article Title: Lipocalin 2 orchestrates resistance to ferroptosis via AXL.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Phosphatase inhibitor cocktail Sigma-Aldrich Cat #P5725 PMSF Sigma-Aldrich Cat #10837091001 Sodium acetate ThermoFisher Cat #A13184-30 Thioglycolic acid Fisher Scientific Cat #M0052252G Chromogenic solution (FerroZine) MedChemExpress Cat #HY-137805 FITC-annexin V BioLegend Cat #640914 DRAQ7 ThermoFisher Cat #D15105 Critical commercial assays CellTiter Glo Cell Viability Assay Promega Cat #G7573 RNeasy Mini Kit Qiagen Cat #74106 qScript cDNA SuperMix Quanta Biosciences Cat #95048-100 Fast SYBR Green Mastermix ThermoFisher Cat #4385618 Proteome Profiler Mouse Phospho-RTK Array Kit R&D Systems Cat#ARY014 Experimental models: Cell lines OL61 (mouse glioma) Castro-Lowenstein Laboratory, Univ. .. Michigan See STAR Methods KR158 (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods CPA (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods Experimental models: Organisms/strains C57BL/6 JAX RRID:IMSR_JAX:000664 NOD.Cg-Prkdc scid Il2rg tm1Wjl /SzJ Biological Resources Unit, Lerner Research Institute; Cleveland Clinic – B6.129P2-Lcn2 tm1Aade /AkiJ KAX RRID:IMSR_JAX:024630 Oligonucleotides LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 LCN2 Reverse: TTCCGCGGGTGACAGGGCTTC This paper See Table S1 GAPDH Forward: AGGCTGGTGACGAGGATTTG This paper See Table S1 GAPDH Reverse: TGTAGACCAGTATGTTGAGGTCA This paper See Table S1 LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 AXL Forward: ATGGCCGACATTGCCAGTG This paper See Table S1 AXL Reverse: CGGTAGTAATCCCCGTTGTAGA This paper See Table S1 OPCML Forward: CCACCCTCAGGTGTACCATAG This paper See Table S1 OPCML Reverse: GTAGGCGTGTTGACCAAAATGA This paper See Table S1 Gas6 Forward: TGCTGGCTTCCGAGTCTTC This paper See Table S1 Gas6 Reverse: CGGGGTCGTTCTCGAACAC This paper See Table S1 TENC1 Forward: TGAACCACTCAAAGCAACGCA This paper See Table S1 TENC1 Reverse: CGTTACATAGGTGAGGTCCAAGT This paper See Table S1 Recombinant DNA psPAX2 Addgene (Didier Trono) RRID:Addgene_12260; Cat# 12260 pMD2.G Addgene (Didier Trono) RRID:Addgene_12259; Cat# 12259 MISSION pLKO.1-puro Non-Mammalian shRNA Control Sigma TRC #SHC002 Lcn2 shRNA KD1 Sigma TRC #TRCN0000055328 Lcn2 shRNA KD2 Sigma TRC #TRCN0000055331 Lcn2 shRNA KD3 Sigma TRC #TRCN0000055332 Software and algorithms PRISM GraphPad https://www.graphpad.com/ FlowJo v10 BD Biosciences https://www.flowjo.com/ (Continued on next page) Cell Reports 45, 116965, March 24, 2026 17 .. STAR★METHODS Detailed methods are provided in the online version of this paper and include the following: • KEY RESOURCES TABLE • EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS ○ Sex as a biological variable ○ Cell culture ○ Intracranial tumor cell implantation ○ Patient mRNA expression and survival ○ Protein analysis of banked human samples ○ Study approval • METHOD DETAILS ○ Cell viability and functional assays ○ Lipid peroxidation ○ Cell number and proliferation ○ IC 50 assessment of drugs and drug matrix ○ Quantitative real-time PCR ○ Protein analysis ○ Enzyme-linked immunosorbent assay ○ Lcn2 genetic manipulation via short hairpin RNA knockdown ○ Iron measurements ○ Histology Cell Reports 45, 116965, March 24, 2026 11 • QUANTIFICATION AND STATISTICAL ANALYSIS SUPPLEMENTAL INFORMATION Supplemental information can be found online at https://doi.org/10.1016/j.

    Article Title: Functional chromatin signatures premark future lineage-specific enhancers.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and gRNAs N/A Recombinant DNA Lenti-dCas9-VP64 Addgene (Konermann et al.15) Cat# 61425 Lenti-EF1-MS2-P65-HSF1 Addgene (Konermann et al.15) Cat# 61426 LentiGuide-Puromycin Addgene (Sanjana et al.52) Cat# 52963 Lenti MS2 grna-Puromycin Addgene (Konermann et al.15) Cat# 73795 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat12259 CROP-sgRNA-MS2 Addgene (Alda-Catalinas et al.26) Cat#153457 Software and algorithms ImageJ Schneider et al.53 https://ImageJ.net/ Flowjo BD Life Sciences https://flowjo.com/ Model-based Analysis of ChIP-Seq (MACS) Zhang et al.54 https://macs3-project.github.io/MACS/ HOMER Heinz et al.23 http://homer.ucsd.edu/homer/index.html SCEPTRE Barry et al.28 https://katsevich-lab.github.io/sceptre/ Other Essential 8 (E8) Thermo Fisher Scientific A1517001 AMPure XP beads Beckman Coulter A63881 TrypLE Select Gibco 12563029 e2 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS Memorial Sloan Kettering Cancer Center (MSKCC) Antibody & Bioresource Core Facility to verify they were mycoplasma-free. ..

    Article Title: A bispecific nanobody-drug conjugate targeting TROP2 and c-Met for low-concentration, single-dose treatment of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: C57BL/6-Egfrtm2(EGFR)Bcgen Mettm1(MET)Bcgen Hgftm2(HGF)Bcgen/ Bcgen Biocytogen Cat#112258 Recombinant DNA pMCS-Gaussia-Dura Luc Vector for Luciferase Assays Thermo Fisher Cat#16190 pCDH-CMV-MCS-EF1-CopGFP-T2A-Puro NovoPro Cat#V012884 psPAX2 addgene Cat#12260 pMD2.G addgene Cat12259 Software and algorithms ImageJ Java 1.8.0_345 (64-bit) National Institutes of Health https://imagej.net/ij/ GraphPad Prism (v8.0) GraphPad https://www.graphpad.com/ Flowjo (v10.0.7) BD Life Sciences https://www.flowjo.com/ ZEN (blue edition v3.3) Carl Zeiss https://www.zeiss.com.cn/microscopy/ products/software/zeiss-zen.html LAS X office 1.4.7.28982 LAS X Life Science https://www.leica-microsystems.com.cn/ cn/c/gl/las-x-software-registration/ Living image (v4.4) Revvity https://www.revvity.cn/category/in-vivo- imaging-software SnapGene (v6.0.2) GSL Biotech LLC https://www.snapgene.com/ Other LSRFortessaX-20 BD Biosciences https://www.bdbiosciences.com/zh-cn TEM (HT7800) Hitachi https://www.hitachi.com.cn/ Biacore TM 8 series SPR systems Cytiva https://www.cytivalifesciences.com/ TCS SP8 X Leica https://www.leica-microsystems.com.cn/ cn/ Xevo G3 QTof Waters https://www.waters.com/nextgen/cn/zh. html Protein structure prediction AlphaFold 3 https://alphafold.com/ Cell Reports Medicine 7, 102688, April 21, 2026 e3 OPEN ACCESS sections underwent antigen retrieval and were then blocked. .. Antibodies against TROP2 (27360-1-AP, Proteintech) and c-Met (25869-1-AP, Proteintech) were applied at dilutions of 1:200 and 1:2000, respectively, and incubated for one hour at room temperature.

    Micro-CT:

    Article Title: An orthogonal CRISPR/Cpf1 platform for precise spatiotemporal gene regulation and osteoporotic fracture repair.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER TIDE analysis primers, See: Table S4 This paper N/A Recombinant DNA OREC Effector sequences, see: Table S5 This paper N/A pAAV-MCS2 Addgene Cat# 46954 pAAV2/9 Addgene Cat# 112865 pHelper plasmid Addgene Cat# 112867 pcDNA3.1+N-DYK GenScript NA pUC57-Kan Addgene 121344 pCDH-CMV Addgene Cat# 72265 pCDH-CMV-MCS-EF1-copGFP System Biosciences Cat# CD511B-1 pMDLg/pRRE Addgene Cat# 12251 pRSV-Rev Addgene Cat# 12253 pMD2.G Addgene Cat# 12259 Software and algorithms GraphPad Prism 9 GraphPad Software https://www.graphpad.com NanoDrop 2000 Thermo Fisher Scientific https://www.thermofisher.com Skyscan Micro-CT software Bruker https://www.bruker.com ImageJ software NIH https://imagej.nih.gov/ij/ e2 Cell Reports Methods 6, 101299, February 23, 2026 Article ll OPEN ACCESS positioned directly over the fracture site. ..

    other:

    Article Title: Programmable iPSC-derived CAR-NK vesicles remodel the immune microenvironment and eradicate tumors.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse Ccl5 ELISA Kit JONLNBIO Cat#JL17335 Mouse Cxcl1 ELISA Kit JONLNBIO Cat#JL20150 Mouse Cxcl5 ELISA Kit JONLNBIO Cat#JL28925 Mouse IL-1α ELISA Kit JONLNBIO Cat#JL13044 Mouse IL-1β ELISA Kit JONLNBIO Cat#JL18442 Mouse IL-6 ELISA Kit JONLNBIO Cat#JL20268 Mouse Tnf-α ELISA Kit JONLNBIO Cat#JL10484 Mouse Csf3 ELISA Kit JONLNBIO Cat#JL10697 Mouse Cxcl2 ELISA Kit Abnova Cat#KA1505 Deposited data Single-cell sequencing data This paper GEO: GSE293929 Experimental models: Cell lines HEK 293T/17 ATCC Cat#CRL-11268 K562 ATCC Cat#CCL-243 Panc02 ATCC Cat#CRL-2553 Mouse iPSC Alstem Cat#iPS02M Human iPSC ATCC Cat#ACS-1027 H22 Ubigene Biosciences Cat#YC-C053 Colon26 Creative biogene Cat#CSC-RR0461 Hep-53.4 CLS Cell Lines Service Cat#400200 Panc02-Luc This paper N/A Colon26-Luc This paper N/A Hep-53.4-Luc This paper N/A Experimental models: Organisms/strains F4/80-Cre mice The Jackson laboratory N/A huHSC-NCG-M Gempharmatech Cat#T057533 BALB/c Mice Charles Cat#028 C57BL/6 Mice Charles Cat#027 C57BL/6Smoc-Nos2em1(flox)Smoc Shanghai Model Organisms Cat#NM-CKO-226494 Macrophage-specific Nos2-KO mice This paper N/A Recombinant DNA pCDH-CMV-MCS-EF1α-GreenPuro System Biosciences Cat#CD513B-1 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat#12259 pLVX-mbIL-21-puro Addgene Cat#125839 Luciferase lentivirus Applied Biological Materials Cat#LVP010079 pET-14B-CD133 This paper N/A Software and algorithms ImageJ Schneider et al.45 https://imagej.net/ij/ Graphpad Prism version 10.0 GraphPad software https://www.graphpad.com FlowJo 10.0 FlowJo, LLC https://www.flowjo.com/ Living Image software v4.5 PerkinElmer N/A SPSS 20.0 IBM https://www.ibm.com/it-it/products/ spss-statistics Biacore S200 Evaluation software Cytiva https://www.cytivalifesciences.com/en/ us/support/software/biacore-downloads/ Biorender Biorender https://app.biorender.com/ Other Nanobodies targeting CD133 This paper N/A Cell Reports Medicine 7, 102545, February 17, 2026 e3 Article ll OPEN ACCESS

    Article Title: The HIF-2 transcription factor mediates resistance to ferroptosis in pancreatic cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: PANC-1 HIF-1α KO Clone 1 (CRISPR- Cas9); mCherry+ This paper N/A Human: PANC-1 HIF-1α KO Clone 2 (CRISPR- Cas9); mCherry+ This paper N/A Human: PANC-1 HIF-1α KO Clone 3 (CRISPR- Cas9); mCherry+ This paper N/A Human: PANC-1 HIF-2α KO Clone 1 (CRISPR-Cas9); GFP+ This paper N/A Human: PANC-1 HIF-2α KO Clone 2 (CRISPR-Cas9); GFP+ This paper N/A Human: PANC-1 HIF-2α KO Clone 3 (CRISPR-Cas9); GFP+ This paper N/A Human: PANC-1 ARNT KO Clone 1 (CRISPR-Cas9); GFP+ This paper N/A Human: PANC-1 ARNT KO Clone 2 (CRISPR-Cas9); GFP+ This paper N/A Human: PANC-1 Dox-Inducible shRNA-HIF-2α This paper N/A Human: PANC-1 Dox-Inducible HIF-1α (P402/564A) This paper N/A Human: PANC-1 Dox-Inducible HIF-2α (P402/564A) This paper N/A Human: PANC-1 Cas9+; GFP+ This paper N/A Human: PANC-1 Cas9+; mCherry+ This paper N/A Human: MiaPaCa HIF-1α KO Clone 1 (CRISPR-Cas9); GFP+ This paper N/A Human: MiaPaCa HIF-2α KO Clone 1 (CRISPR-Cas9); GFP+ This paper N/A Human: MiaPaCa HIF-2α KO Clone 2 (CRISPR-Cas9); GFP+ This paper N/A Human: AsPC-1 ATCC Cat# CRL-1682 Human: SW1990 ATCC Cat# CRL-2172 Human: CFPAC-1 ATCC Cat# CRL-1918 Human: BxPC-3 ATCC Cat# CRL-1687 Human: RCC4 Laboratory of Celeste Simon N/A Mouse: 6694 Laboratory of Ben Stanger48 N/A Experimental models: Organisms/strains Nod-Scid Gamma (NSG) Mice Johns Hopkins Animal Facility N/A Oligonucleotides All primers and sgRNAs used in this study (see Table S5) This paper Table S5 Recombinant DNA pCDH-EF1-FHC Addgene Cat# 64874 pCW57-MCS1-P2A-MCS2 Addgene Cat# 80921 psPAX2 Addgene Cat# 12260 pMD2.g Addgene Cat# 12259 LRG (lenti-sgRNA-EFS-GFP) Addgene Cat# 65656 LRG-sgRNA-HIF-2α-guide 1 - GFP This paper N/A LRG-sgRNA-HIF-2α-guide 2 – GFP This paper N/A LRG-sgRNA-HIF-2α-guide 3 – GFP This paper N/A LRG-sgRNA-ARNT-guide A – GFP This paper N/A (Continued on next page) e2 Molecular Cell 86, 1260–1274.e1–e4, April 2, 2026

    Article Title: Self-clustering of three CBX2 molecules drives PRC2 to promote facultative heterochromatinization of Polycomb target genes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: FLAG-LoxP-PURO-LoxP-HaloTERT WT HR Donor Addgene Cat# 86843 Plasmid: pUC19-LoxP-PURO-N-HaloTag Brown et al. 17 N/A Plasmid: pUC19-HaloTag-C Brown et al. 17 N/A Plasmid: pUC19-LoxP-PURO-N-HaloTag Brown et al. 17 N/A Plasmid: The pUC19-LoxP-PURO-NHaloTag-CBX2 Brown et al. 17 N/A Plasmid: pUC19-CBX2 fl/fl -HaloTag Brown et al. 17 N/A Plasmid: pUC19-RING1B-HaloTag This Study N/A Plasmid: pUC19-CBX7-HaloTag This Study N/A Plasmid: pUC19-RING1A-HaloTag This Study N/A Plasmid: pUC19-Mel18-HaloTag This Study N/A Plasmid: pUC19-EZH2-HaloTag This Study N/A Plasmid: pUC19-HaloTag-PHC1 This Study N/A Plasmid: pUC19-CBX7-Venus-dTag Brown et al. 17 N/A Plasmid: pUC19-RING1B-Venus-dTag This Study N/A Plasmid: pUC19-EZH2-Venus-dTag This Study N/A Plasmid: pUC19-Suz12-Venus-dTag This Study N/A Plasmid: pUC19-CBX2 PSM -HaloTag This Study N/A Plasmid: pGEX-6p-1 Sigma Cat# GE28-9546-48 Plasmid: pGEX-GST-YFP-FLAG Tatavosian et al. 11 N/A Plasmid: pGEX-GST-CBX2-YFP-FLAG Tatavosian et al. 11 N/A Plasmid: pGEX-GST-CBX2 PSM -YFP-FLAG This Study N/A Plasmid: pGEX-GST-RING1B-FLAG Brown et al. 17 N/A Plasmid: pGEX-GST-MEL18-FLAG Brown et al. 17 N/A Plasmid: pGEX-GST-PHC1-FLAG Brown et al. 17 N/A Plasmid: pTRIPZ(M)-YFP Zhen et al. 45 N/A Plasmid: pTRIPZ-HT-CBX2 Brown et al. 17 N/A Plasmid: pTRIPZ(M)-EZH2-YFP Tatavosian et al. 46 N/A Plasmid: pTRIPZ(M)-SUZ12-YFP This Study N/A Plasmid: pCMVHA SUZ12 Addgene Cat# 24232 Plasmid: pCMVHA hEZH2 Addgene Cat# 24230 Plasmid: pMD2.G Addgene Cat# 12259 Plasmid: psPAX2 Addgene Cat# 12260 Plasmid: pBS598-EF1alpha-EGFPcre Addgene Cat# 11923 Plasmid: pUC19-TetraNuc-(PromoterEVX2) This Study N/A Software and algorithms Adobe Photoshop Adobe Inc https://www.adobe.com/ Adobe Illustrator Adobe Inc https://www.adobe.com/ CellProfiler BROAD Institute cellprofiler.org Fiji (ImageJ) NIH imagej.net/software/fiji OriginLab OriginLab Corporation https://www.originlab.com/ Zen Black software Zeiss, Germany https://www.micro-shop.zeiss.com/en/us/ softwarefinder/software-categories/zen-black/ SlideBook 6.0 Software 3i https://www.intelligent-imaging.com/ Cutadapt Martin et al. 64 https://cutadapt.readthedocs.io/en/stable/ SamTools Li et al. 65 https://www.htslib.org/ Bowtie2 Langmead and Salzberg 66 https://bowtie-bio.sourceforge.net/bowtie2/ index.shtml (Continued on next page) Molecular Cell 86, 1–17.e1–e16, March 19, 2026 e4


    shRNA:

    Article Title: Lipocalin 2 orchestrates resistance to ferroptosis via AXL.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Phosphatase inhibitor cocktail Sigma-Aldrich Cat #P5725 PMSF Sigma-Aldrich Cat #10837091001 Sodium acetate ThermoFisher Cat #A13184-30 Thioglycolic acid Fisher Scientific Cat #M0052252G Chromogenic solution (FerroZine) MedChemExpress Cat #HY-137805 FITC-annexin V BioLegend Cat #640914 DRAQ7 ThermoFisher Cat #D15105 Critical commercial assays CellTiter Glo Cell Viability Assay Promega Cat #G7573 RNeasy Mini Kit Qiagen Cat #74106 qScript cDNA SuperMix Quanta Biosciences Cat #95048-100 Fast SYBR Green Mastermix ThermoFisher Cat #4385618 Proteome Profiler Mouse Phospho-RTK Array Kit R&D Systems Cat#ARY014 Experimental models: Cell lines OL61 (mouse glioma) Castro-Lowenstein Laboratory, Univ. .. Michigan See STAR Methods KR158 (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods CPA (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods Experimental models: Organisms/strains C57BL/6 JAX RRID:IMSR_JAX:000664 NOD.Cg-Prkdc scid Il2rg tm1Wjl /SzJ Biological Resources Unit, Lerner Research Institute; Cleveland Clinic – B6.129P2-Lcn2 tm1Aade /AkiJ KAX RRID:IMSR_JAX:024630 Oligonucleotides LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 LCN2 Reverse: TTCCGCGGGTGACAGGGCTTC This paper See Table S1 GAPDH Forward: AGGCTGGTGACGAGGATTTG This paper See Table S1 GAPDH Reverse: TGTAGACCAGTATGTTGAGGTCA This paper See Table S1 LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 AXL Forward: ATGGCCGACATTGCCAGTG This paper See Table S1 AXL Reverse: CGGTAGTAATCCCCGTTGTAGA This paper See Table S1 OPCML Forward: CCACCCTCAGGTGTACCATAG This paper See Table S1 OPCML Reverse: GTAGGCGTGTTGACCAAAATGA This paper See Table S1 Gas6 Forward: TGCTGGCTTCCGAGTCTTC This paper See Table S1 Gas6 Reverse: CGGGGTCGTTCTCGAACAC This paper See Table S1 TENC1 Forward: TGAACCACTCAAAGCAACGCA This paper See Table S1 TENC1 Reverse: CGTTACATAGGTGAGGTCCAAGT This paper See Table S1 Recombinant DNA psPAX2 Addgene (Didier Trono) RRID:Addgene_12260; Cat# 12260 pMD2.G Addgene (Didier Trono) RRID:Addgene_12259; Cat# 12259 MISSION pLKO.1-puro Non-Mammalian shRNA Control Sigma TRC #SHC002 Lcn2 shRNA KD1 Sigma TRC #TRCN0000055328 Lcn2 shRNA KD2 Sigma TRC #TRCN0000055331 Lcn2 shRNA KD3 Sigma TRC #TRCN0000055332 Software and algorithms PRISM GraphPad https://www.graphpad.com/ FlowJo v10 BD Biosciences https://www.flowjo.com/ (Continued on next page) Cell Reports 45, 116965, March 24, 2026 17 .. STAR★METHODS Detailed methods are provided in the online version of this paper and include the following: • KEY RESOURCES TABLE • EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS ○ Sex as a biological variable ○ Cell culture ○ Intracranial tumor cell implantation ○ Patient mRNA expression and survival ○ Protein analysis of banked human samples ○ Study approval • METHOD DETAILS ○ Cell viability and functional assays ○ Lipid peroxidation ○ Cell number and proliferation ○ IC 50 assessment of drugs and drug matrix ○ Quantitative real-time PCR ○ Protein analysis ○ Enzyme-linked immunosorbent assay ○ Lcn2 genetic manipulation via short hairpin RNA knockdown ○ Iron measurements ○ Histology Cell Reports 45, 116965, March 24, 2026 11 • QUANTIFICATION AND STATISTICAL ANALYSIS SUPPLEMENTAL INFORMATION Supplemental information can be found online at https://doi.org/10.1016/j.

    Control:

    Article Title: Lipocalin 2 orchestrates resistance to ferroptosis via AXL.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Phosphatase inhibitor cocktail Sigma-Aldrich Cat #P5725 PMSF Sigma-Aldrich Cat #10837091001 Sodium acetate ThermoFisher Cat #A13184-30 Thioglycolic acid Fisher Scientific Cat #M0052252G Chromogenic solution (FerroZine) MedChemExpress Cat #HY-137805 FITC-annexin V BioLegend Cat #640914 DRAQ7 ThermoFisher Cat #D15105 Critical commercial assays CellTiter Glo Cell Viability Assay Promega Cat #G7573 RNeasy Mini Kit Qiagen Cat #74106 qScript cDNA SuperMix Quanta Biosciences Cat #95048-100 Fast SYBR Green Mastermix ThermoFisher Cat #4385618 Proteome Profiler Mouse Phospho-RTK Array Kit R&D Systems Cat#ARY014 Experimental models: Cell lines OL61 (mouse glioma) Castro-Lowenstein Laboratory, Univ. .. Michigan See STAR Methods KR158 (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods CPA (mouse glioma) Deleyrolle Laboratory, Mayo Clinic See STAR Methods Experimental models: Organisms/strains C57BL/6 JAX RRID:IMSR_JAX:000664 NOD.Cg-Prkdc scid Il2rg tm1Wjl /SzJ Biological Resources Unit, Lerner Research Institute; Cleveland Clinic – B6.129P2-Lcn2 tm1Aade /AkiJ KAX RRID:IMSR_JAX:024630 Oligonucleotides LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 LCN2 Reverse: TTCCGCGGGTGACAGGGCTTC This paper See Table S1 GAPDH Forward: AGGCTGGTGACGAGGATTTG This paper See Table S1 GAPDH Reverse: TGTAGACCAGTATGTTGAGGTCA This paper See Table S1 LCN2 Forward: AGCCGTGGTAGATGGCTAGG This paper See Table S1 AXL Forward: ATGGCCGACATTGCCAGTG This paper See Table S1 AXL Reverse: CGGTAGTAATCCCCGTTGTAGA This paper See Table S1 OPCML Forward: CCACCCTCAGGTGTACCATAG This paper See Table S1 OPCML Reverse: GTAGGCGTGTTGACCAAAATGA This paper See Table S1 Gas6 Forward: TGCTGGCTTCCGAGTCTTC This paper See Table S1 Gas6 Reverse: CGGGGTCGTTCTCGAACAC This paper See Table S1 TENC1 Forward: TGAACCACTCAAAGCAACGCA This paper See Table S1 TENC1 Reverse: CGTTACATAGGTGAGGTCCAAGT This paper See Table S1 Recombinant DNA psPAX2 Addgene (Didier Trono) RRID:Addgene_12260; Cat# 12260 pMD2.G Addgene (Didier Trono) RRID:Addgene_12259; Cat# 12259 MISSION pLKO.1-puro Non-Mammalian shRNA Control Sigma TRC #SHC002 Lcn2 shRNA KD1 Sigma TRC #TRCN0000055328 Lcn2 shRNA KD2 Sigma TRC #TRCN0000055331 Lcn2 shRNA KD3 Sigma TRC #TRCN0000055332 Software and algorithms PRISM GraphPad https://www.graphpad.com/ FlowJo v10 BD Biosciences https://www.flowjo.com/ (Continued on next page) Cell Reports 45, 116965, March 24, 2026 17 .. STAR★METHODS Detailed methods are provided in the online version of this paper and include the following: • KEY RESOURCES TABLE • EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS ○ Sex as a biological variable ○ Cell culture ○ Intracranial tumor cell implantation ○ Patient mRNA expression and survival ○ Protein analysis of banked human samples ○ Study approval • METHOD DETAILS ○ Cell viability and functional assays ○ Lipid peroxidation ○ Cell number and proliferation ○ IC 50 assessment of drugs and drug matrix ○ Quantitative real-time PCR ○ Protein analysis ○ Enzyme-linked immunosorbent assay ○ Lcn2 genetic manipulation via short hairpin RNA knockdown ○ Iron measurements ○ Histology Cell Reports 45, 116965, March 24, 2026 11 • QUANTIFICATION AND STATISTICAL ANALYSIS SUPPLEMENTAL INFORMATION Supplemental information can be found online at https://doi.org/10.1016/j.

    Single Cell:

    Article Title: Functional chromatin signatures premark future lineage-specific enhancers.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and gRNAs N/A Recombinant DNA Lenti-dCas9-VP64 Addgene (Konermann et al.15) Cat# 61425 Lenti-EF1-MS2-P65-HSF1 Addgene (Konermann et al.15) Cat# 61426 LentiGuide-Puromycin Addgene (Sanjana et al.52) Cat# 52963 Lenti MS2 grna-Puromycin Addgene (Konermann et al.15) Cat# 73795 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat12259 CROP-sgRNA-MS2 Addgene (Alda-Catalinas et al.26) Cat#153457 Software and algorithms ImageJ Schneider et al.53 https://ImageJ.net/ Flowjo BD Life Sciences https://flowjo.com/ Model-based Analysis of ChIP-Seq (MACS) Zhang et al.54 https://macs3-project.github.io/MACS/ HOMER Heinz et al.23 http://homer.ucsd.edu/homer/index.html SCEPTRE Barry et al.28 https://katsevich-lab.github.io/sceptre/ Other Essential 8 (E8) Thermo Fisher Scientific A1517001 AMPure XP beads Beckman Coulter A63881 TrypLE Select Gibco 12563029 e2 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS Memorial Sloan Kettering Cancer Center (MSKCC) Antibody & Bioresource Core Facility to verify they were mycoplasma-free. ..

    Chromatin Immunoprecipitation:

    Article Title: Functional chromatin signatures premark future lineage-specific enhancers.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and gRNAs N/A Recombinant DNA Lenti-dCas9-VP64 Addgene (Konermann et al.15) Cat# 61425 Lenti-EF1-MS2-P65-HSF1 Addgene (Konermann et al.15) Cat# 61426 LentiGuide-Puromycin Addgene (Sanjana et al.52) Cat# 52963 Lenti MS2 grna-Puromycin Addgene (Konermann et al.15) Cat# 73795 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat12259 CROP-sgRNA-MS2 Addgene (Alda-Catalinas et al.26) Cat#153457 Software and algorithms ImageJ Schneider et al.53 https://ImageJ.net/ Flowjo BD Life Sciences https://flowjo.com/ Model-based Analysis of ChIP-Seq (MACS) Zhang et al.54 https://macs3-project.github.io/MACS/ HOMER Heinz et al.23 http://homer.ucsd.edu/homer/index.html SCEPTRE Barry et al.28 https://katsevich-lab.github.io/sceptre/ Other Essential 8 (E8) Thermo Fisher Scientific A1517001 AMPure XP beads Beckman Coulter A63881 TrypLE Select Gibco 12563029 e2 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS Memorial Sloan Kettering Cancer Center (MSKCC) Antibody & Bioresource Core Facility to verify they were mycoplasma-free. ..

    Magnetic Cell Separation:

    Article Title: Functional chromatin signatures premark future lineage-specific enhancers.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Previously deposited data https://data.4dnucleome.org 4DNESDO2ZYBM, 4DNESQMUTYXH, 4DNESFL8KDMT Oligonucleotides gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR1-R cctctaaggtttgcttacga This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-R tgggggttagacccaatatc This paper N/A gRNAs to target the dCas9-VP64 and dCas9-KRAB cassettes to AAVS1 locus CR2-L attcccagggccggttaatg This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Fw gtgactgg agttcagacgtgtgctcttccgatctcttgtggaaa ggacgaaacac This paper N/A Primers to amplify gRNA libraries from CRISPRa + Single Cell 10× Rv ctacacgacgctcttccgatct This paper N/A See Table S8 for additional oligos, primers and gRNAs N/A Recombinant DNA Lenti-dCas9-VP64 Addgene (Konermann et al.15) Cat# 61425 Lenti-EF1-MS2-P65-HSF1 Addgene (Konermann et al.15) Cat# 61426 LentiGuide-Puromycin Addgene (Sanjana et al.52) Cat# 52963 Lenti MS2 grna-Puromycin Addgene (Konermann et al.15) Cat# 73795 psPAX2 Addgene Cat#12260 pMD2.G Addgene Cat12259 CROP-sgRNA-MS2 Addgene (Alda-Catalinas et al.26) Cat#153457 Software and algorithms ImageJ Schneider et al.53 https://ImageJ.net/ Flowjo BD Life Sciences https://flowjo.com/ Model-based Analysis of ChIP-Seq (MACS) Zhang et al.54 https://macs3-project.github.io/MACS/ HOMER Heinz et al.23 http://homer.ucsd.edu/homer/index.html SCEPTRE Barry et al.28 https://katsevich-lab.github.io/sceptre/ Other Essential 8 (E8) Thermo Fisher Scientific A1517001 AMPure XP beads Beckman Coulter A63881 TrypLE Select Gibco 12563029 e2 Cell Genomics 6, 101189, May 13, 2026 Article ll OPEN ACCESS Memorial Sloan Kettering Cancer Center (MSKCC) Antibody & Bioresource Core Facility to verify they were mycoplasma-free. ..

    Luciferase:

    Article Title: A bispecific nanobody-drug conjugate targeting TROP2 and c-Met for low-concentration, single-dose treatment of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: C57BL/6-Egfrtm2(EGFR)Bcgen Mettm1(MET)Bcgen Hgftm2(HGF)Bcgen/ Bcgen Biocytogen Cat#112258 Recombinant DNA pMCS-Gaussia-Dura Luc Vector for Luciferase Assays Thermo Fisher Cat#16190 pCDH-CMV-MCS-EF1-CopGFP-T2A-Puro NovoPro Cat#V012884 psPAX2 addgene Cat#12260 pMD2.G addgene Cat12259 Software and algorithms ImageJ Java 1.8.0_345 (64-bit) National Institutes of Health https://imagej.net/ij/ GraphPad Prism (v8.0) GraphPad https://www.graphpad.com/ Flowjo (v10.0.7) BD Life Sciences https://www.flowjo.com/ ZEN (blue edition v3.3) Carl Zeiss https://www.zeiss.com.cn/microscopy/ products/software/zeiss-zen.html LAS X office 1.4.7.28982 LAS X Life Science https://www.leica-microsystems.com.cn/ cn/c/gl/las-x-software-registration/ Living image (v4.4) Revvity https://www.revvity.cn/category/in-vivo- imaging-software SnapGene (v6.0.2) GSL Biotech LLC https://www.snapgene.com/ Other LSRFortessaX-20 BD Biosciences https://www.bdbiosciences.com/zh-cn TEM (HT7800) Hitachi https://www.hitachi.com.cn/ Biacore TM 8 series SPR systems Cytiva https://www.cytivalifesciences.com/ TCS SP8 X Leica https://www.leica-microsystems.com.cn/ cn/ Xevo G3 QTof Waters https://www.waters.com/nextgen/cn/zh. html Protein structure prediction AlphaFold 3 https://alphafold.com/ Cell Reports Medicine 7, 102688, April 21, 2026 e3 OPEN ACCESS sections underwent antigen retrieval and were then blocked. .. Antibodies against TROP2 (27360-1-AP, Proteintech) and c-Met (25869-1-AP, Proteintech) were applied at dilutions of 1:200 and 1:2000, respectively, and incubated for one hour at room temperature.

    Imaging:

    Article Title: A bispecific nanobody-drug conjugate targeting TROP2 and c-Met for low-concentration, single-dose treatment of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: C57BL/6-Egfrtm2(EGFR)Bcgen Mettm1(MET)Bcgen Hgftm2(HGF)Bcgen/ Bcgen Biocytogen Cat#112258 Recombinant DNA pMCS-Gaussia-Dura Luc Vector for Luciferase Assays Thermo Fisher Cat#16190 pCDH-CMV-MCS-EF1-CopGFP-T2A-Puro NovoPro Cat#V012884 psPAX2 addgene Cat#12260 pMD2.G addgene Cat12259 Software and algorithms ImageJ Java 1.8.0_345 (64-bit) National Institutes of Health https://imagej.net/ij/ GraphPad Prism (v8.0) GraphPad https://www.graphpad.com/ Flowjo (v10.0.7) BD Life Sciences https://www.flowjo.com/ ZEN (blue edition v3.3) Carl Zeiss https://www.zeiss.com.cn/microscopy/ products/software/zeiss-zen.html LAS X office 1.4.7.28982 LAS X Life Science https://www.leica-microsystems.com.cn/ cn/c/gl/las-x-software-registration/ Living image (v4.4) Revvity https://www.revvity.cn/category/in-vivo- imaging-software SnapGene (v6.0.2) GSL Biotech LLC https://www.snapgene.com/ Other LSRFortessaX-20 BD Biosciences https://www.bdbiosciences.com/zh-cn TEM (HT7800) Hitachi https://www.hitachi.com.cn/ Biacore TM 8 series SPR systems Cytiva https://www.cytivalifesciences.com/ TCS SP8 X Leica https://www.leica-microsystems.com.cn/ cn/ Xevo G3 QTof Waters https://www.waters.com/nextgen/cn/zh. html Protein structure prediction AlphaFold 3 https://alphafold.com/ Cell Reports Medicine 7, 102688, April 21, 2026 e3 OPEN ACCESS sections underwent antigen retrieval and were then blocked. .. Antibodies against TROP2 (27360-1-AP, Proteintech) and c-Met (25869-1-AP, Proteintech) were applied at dilutions of 1:200 and 1:2000, respectively, and incubated for one hour at room temperature.

    Transmission Electron Microscopy:

    Article Title: A bispecific nanobody-drug conjugate targeting TROP2 and c-Met for low-concentration, single-dose treatment of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: C57BL/6-Egfrtm2(EGFR)Bcgen Mettm1(MET)Bcgen Hgftm2(HGF)Bcgen/ Bcgen Biocytogen Cat#112258 Recombinant DNA pMCS-Gaussia-Dura Luc Vector for Luciferase Assays Thermo Fisher Cat#16190 pCDH-CMV-MCS-EF1-CopGFP-T2A-Puro NovoPro Cat#V012884 psPAX2 addgene Cat#12260 pMD2.G addgene Cat12259 Software and algorithms ImageJ Java 1.8.0_345 (64-bit) National Institutes of Health https://imagej.net/ij/ GraphPad Prism (v8.0) GraphPad https://www.graphpad.com/ Flowjo (v10.0.7) BD Life Sciences https://www.flowjo.com/ ZEN (blue edition v3.3) Carl Zeiss https://www.zeiss.com.cn/microscopy/ products/software/zeiss-zen.html LAS X office 1.4.7.28982 LAS X Life Science https://www.leica-microsystems.com.cn/ cn/c/gl/las-x-software-registration/ Living image (v4.4) Revvity https://www.revvity.cn/category/in-vivo- imaging-software SnapGene (v6.0.2) GSL Biotech LLC https://www.snapgene.com/ Other LSRFortessaX-20 BD Biosciences https://www.bdbiosciences.com/zh-cn TEM (HT7800) Hitachi https://www.hitachi.com.cn/ Biacore TM 8 series SPR systems Cytiva https://www.cytivalifesciences.com/ TCS SP8 X Leica https://www.leica-microsystems.com.cn/ cn/ Xevo G3 QTof Waters https://www.waters.com/nextgen/cn/zh. html Protein structure prediction AlphaFold 3 https://alphafold.com/ Cell Reports Medicine 7, 102688, April 21, 2026 e3 OPEN ACCESS sections underwent antigen retrieval and were then blocked. .. Antibodies against TROP2 (27360-1-AP, Proteintech) and c-Met (25869-1-AP, Proteintech) were applied at dilutions of 1:200 and 1:2000, respectively, and incubated for one hour at room temperature.

    SPR Assay:

    Article Title: A bispecific nanobody-drug conjugate targeting TROP2 and c-Met for low-concentration, single-dose treatment of pancreatic cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: C57BL/6-Egfrtm2(EGFR)Bcgen Mettm1(MET)Bcgen Hgftm2(HGF)Bcgen/ Bcgen Biocytogen Cat#112258 Recombinant DNA pMCS-Gaussia-Dura Luc Vector for Luciferase Assays Thermo Fisher Cat#16190 pCDH-CMV-MCS-EF1-CopGFP-T2A-Puro NovoPro Cat#V012884 psPAX2 addgene Cat#12260 pMD2.G addgene Cat12259 Software and algorithms ImageJ Java 1.8.0_345 (64-bit) National Institutes of Health https://imagej.net/ij/ GraphPad Prism (v8.0) GraphPad https://www.graphpad.com/ Flowjo (v10.0.7) BD Life Sciences https://www.flowjo.com/ ZEN (blue edition v3.3) Carl Zeiss https://www.zeiss.com.cn/microscopy/ products/software/zeiss-zen.html LAS X office 1.4.7.28982 LAS X Life Science https://www.leica-microsystems.com.cn/ cn/c/gl/las-x-software-registration/ Living image (v4.4) Revvity https://www.revvity.cn/category/in-vivo- imaging-software SnapGene (v6.0.2) GSL Biotech LLC https://www.snapgene.com/ Other LSRFortessaX-20 BD Biosciences https://www.bdbiosciences.com/zh-cn TEM (HT7800) Hitachi https://www.hitachi.com.cn/ Biacore TM 8 series SPR systems Cytiva https://www.cytivalifesciences.com/ TCS SP8 X Leica https://www.leica-microsystems.com.cn/ cn/ Xevo G3 QTof Waters https://www.waters.com/nextgen/cn/zh. html Protein structure prediction AlphaFold 3 https://alphafold.com/ Cell Reports Medicine 7, 102688, April 21, 2026 e3 OPEN ACCESS sections underwent antigen retrieval and were then blocked. .. Antibodies against TROP2 (27360-1-AP, Proteintech) and c-Met (25869-1-AP, Proteintech) were applied at dilutions of 1:200 and 1:2000, respectively, and incubated for one hour at room temperature.



    Similar Products

    addgene pmd2 g  (Addgene inc)
    98
    Addgene inc addgene pmd2 g
    Addgene Pmd2 G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmd2+g+addgene/pMD2%2EG+(Plasmid+%2312259)/pmc12857616-194-6-6
    Average 98 stars, based on 1 article reviews
    addgene pmd2 g - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    pmd2 g pvsv g didier trono addgene plasmid  (Addgene inc)
    98
    Addgene inc pmd2 g pvsv g didier trono addgene plasmid
    Pmd2 G Pvsv G Didier Trono Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmd2+g+addgene/pMD2%2EG+(Plasmid+%2312259)/pm41875887-830-114-117
    Average 98 stars, based on 1 article reviews
    pmd2 g pvsv g didier trono addgene plasmid - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    pmd2 g addgene  (Addgene inc)
    98
    Addgene inc pmd2 g addgene
    Pmd2 G Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmd2+g+addgene/psPAX2+(Plasmid+%2312260)/pm41932308-248-242-243
    Average 98 stars, based on 1 article reviews
    pmd2 g addgene - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    lrg lenti sgrna efs gfp addgene  (Addgene inc)
    98
    Addgene inc lrg lenti sgrna efs gfp addgene
    Lrg Lenti Sgrna Efs Gfp Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmd2+g+addgene/pMD2%2EG+(Plasmid+%2312259)/pm41932308-248-246-248
    Average 98 stars, based on 1 article reviews
    lrg lenti sgrna efs gfp addgene - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    g addgene 12259  (Addgene inc)
    98
    Addgene inc g addgene 12259
    G Addgene 12259, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmd2+g+addgene/pMD2%2EG+(Plasmid+%2312259)/pmc13039848-277-0-1
    Average 98 stars, based on 1 article reviews
    g addgene 12259 - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    pmd2 g addgene plasmid  (Addgene inc)
    98
    Addgene inc pmd2 g addgene plasmid
    Pmd2 G Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmd2+g+addgene/pMD2%2EG+(Plasmid+%2312259)/pm41909949-110-48-49
    Average 98 stars, based on 1 article reviews
    pmd2 g addgene plasmid - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    addgene addgene  (Addgene inc)
    98
    Addgene inc addgene addgene
    Addgene Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmd2+g+addgene/pMD2%2EG+(Plasmid+%2312259)/pm41916275-697-66-67
    Average 98 stars, based on 1 article reviews
    addgene addgene - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    pmd2 g addgene cat  (Addgene inc)
    98
    Addgene inc pmd2 g addgene cat
    Pmd2 G Addgene Cat, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmd2+g+addgene/psPAX2+(Plasmid+%2312260)/us12584105-330-69-70
    Average 98 stars, based on 1 article reviews
    pmd2 g addgene cat - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    pmd2g addgene  (Addgene inc)
    98
    Addgene inc pmd2g addgene
    Pmd2g Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmd2+g+addgene/pMD2%2EG+(Plasmid+%2312259)/pm41865372-468-142-143
    Average 98 stars, based on 1 article reviews
    pmd2g addgene - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    addgene 12259  (Addgene inc)
    98
    Addgene inc addgene 12259
    Addgene 12259, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pmd2+g+addgene/pMD2%2EG+(Plasmid+%2312259)/pmc12997218-32-10-10
    Average 98 stars, based on 1 article reviews
    addgene 12259 - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier

    Image Search Results